rs396481 chr16:84501263 G>C
- Sequence
cacaggtgattcaccaggaagtgg[G/C]aacagcacgcacggggcataagca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HT29 (colon adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.51 | 0.17 | 1.81 | |||
| HT29 (colon adenocarcinoma) | 1.33 | -0.30 | 2.00 |
Items per page:
1 – 2 of 2