rs398706 chr22:23984622 A>T
- Sequence
ataaacaggatgttccagacacac[A/T]ctgcgctacctgcccacatgtctt
- ASB in cell types
- H929 (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| H929 (plasma cell myeloma) | 1.18 | -1.46 | 1.33 |
Items per page:
1 – 1 of 1