rs401157 chr14:31122536 T>C
- Sequence
gtggctcaggctggagtgcagtga[T/C]gcaattatagctcactgcagcctg
- ASB in cell types
- HepG2 (hepatoblastoma) mesenchymal stem cells
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | -1.09 | 1.32 | 1.33 | -0.79 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
