rs401691 chr1:8259575 C>T
- Sequence
aggatgcatttctccccatgactt[C/T]ggcttgtttgggttcgcatttcaa
- ASB in cell types
- breast tumor tissue
- ASB for transcription factors
- GCR_HUMAN ESR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.84 | n/a | 2.00 | n/a | No Hit | |||
| ESR1_HUMAN | n/a | 2.16 | 2.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, mitral annular calcium