rs401826 chr9:134025469 C>T
- Sequence
atggagacacggcccagcggccgc[C/T]ggccccgccctgggagccccgcag
- ASB in cell types
- HepG2 (hepatoblastoma) T47D (invasive ductal carcinoma) NCI-H2171 (small cell lung carcinoma) Ishikawa (endometrial adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.32 | 0.77 | 1.26 | |||
| T47D (invasive ductal carcinoma) | 0.27 | 1.64 | 1.71 | |||
| NCI-H2171 (small cell lung carcinoma) | 1.71 | -0.61 | 1.50 | |||
| Ishikawa (endometrial adenocarcinoma) | -0.56 | 1.46 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Stomach, Testis, Thyroid, Whole_Blood