rs405737 chr15:92665377 T>G
- Sequence
taaagtgctagtttgccagaaagt[T/G]tgcgaaagtcccgaagctaaaata
- ASB in cell types
- liver tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.86 | -0.23 | 1.33 | |||
| tibial nerve | 1.04 | -1.33 | 1.33 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Liver, Muscle_Skeletal, Nerve_Tibial, Ovary, Pituitary, Thyroid