rs4072434 chr2:136256453 C>G
- Sequence
caactgctgtcagggaagaagcct[C/G]tgccccagtgcagggacggtggat
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -1.31 | 1.58 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood