rs4074666 chr15:80562513 C>T
- Sequence
agcaatacatttgaaatcatatta[C/T]aacatcaaagtgtcatacatagaa
- ASB in cell types
- mesenchymal stem cells
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 2.27 | -0.56 | 1.33 | -4.02 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, sporadic creutzfeldt-jakob disease, triglycerides change with statins