rs4077882 chr15:92832280 C>T
- Sequence
tttagaattttctagggtttgttg[C/T]ataagaggaaactgaataattctg
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.00 | -0.26 | 2.00 | |||
| HEK293 (embryonic kidney) | -0.03 | 0.85 | 1.82 | |||
| GM12878 (female B-cells) | 0.65 | 0.38 | 1.34 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, hdl cholesterol change with statins, ldl cholesterol change with statins, total cholesterol change with statins