rs4078431 chr7:151878319 C>T
- Sequence
agggcctttactccttttgaggtg[C/T]gtgctttcgcaggactccctcccc
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) A549 (lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.33 | 0.54 | 1.91 | |||
| HEK293T (embryonic kidney) | 0.10 | 1.06 | 1.77 | |||
| A549 (lung carcinoma) | -1.36 | 1.71 | 2.00 |
Items per page:
1 – 3 of 3