rs408014 chr6:7899161 G>A
- Sequence
ggtccagagtcagtctctgatgct[G/A]gggtacagttgtgaactgtattac
- ASB in cell types
- erythroid progenitors erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid progenitors | 2.32 | -2.00 | 2.00 | |||
| erythroid cells | 2.25 | -1.81 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Muscularis, Heart_Left_Ventricle, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg