rs408376 chr11:131511952 T>C
- Sequence
gtgcagggcccggcccctattcta[T/C]ggtccagaatttccagccatagtg
- ASB in cell types
- MCF10AT1 (breast premetastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF10AT1 (breast premetastatic epithelial cells) | 1.84 | -1.62 | 1.00 |
Items per page:
1 – 1 of 1