rs409154 chr16:77996141 T>G
- Sequence
tcggggtcagcttagattatgcag[T/G]ctaaccctagccaataggggaagg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- P53_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| P53_HUMAN | 0.41 | 1.72 | 2.29 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Skin_Sun_Exposed_Lower_leg, Thyroid