rs4100054 chr4:88539833 A>G
- Sequence
cctccagcaaactccaacagaact[A/G]tagctgagggccctgactgttaga
- ASB in cell types
- K562 (myelogenous leukemia) MCF10AT1 (breast premetastatic epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.63 | 0.77 | 1.41 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting insulin, homa-ir, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in nonasthmatic participants), refractive error, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung