rs410266 chr21:10417704 T>G
- Sequence
accaccatgcccggctaattttgt[T/G]tttttagtagagacagggtttctc
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.66 | 1.34 | 2.14 | |||
| K562 (myelogenous leukemia) | -0.23 | 0.65 | 2.27 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.05 | 0.60 | 2.14 |
Items per page:
1 – 3 of 3