rs410715 chr12:92403983 A>G
- Sequence
tatgagatctgagattagtggtta[A/G]gttggtgccggatgtcatccagca
- ASB in cell types
- fetal proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| fetal proerythroblasts | 1.44 | -1.17 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_EBV-transformed_lymphocytes, Heart_Atrial_Appendage, Small_Intestine_Terminal_Ileum, Spleen