rs410941 chr16:65770149 T>G
- Sequence
agaaatgaagctctcctttccaaa[T/G]ttatgaagtttgccattcttgagg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- TIF1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1A_HUMAN | -1.26 | 1.92 | 2.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), maternal transmission distortion, rheumatoid arthritis, transmission distortion, type 1 diabetes, combined control dataset, gender differentiated