rs412334 chr11:61792789 C>T
- Sequence
ccagggtcgctgagagactctgtt[C/T]tccctggagggactggttgccatg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC3_HUMAN | -2.13 | 2.33 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, ldl cholesterol, plasma alpha-linolenic acid levels, plasma docosapentaenoic acid levels, plasma eicosapentaenoic acid levels, plasma oleic acid, plasma stearic acid, total cholesterol, triglycerides, triglycerides change with statins