rs41278549 chr3:9792854 G>A
- Sequence
ggctgtggcaaaggtgacaagaag[G/A]ccgaaggcacaaagggaagctgca
- ASB in cell types
- HEK293 (embryonic kidney) HEK293T (embryonic kidney) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.17 | 0.05 | 1.74 | |||
| HEK293T (embryonic kidney) | -0.35 | 1.51 | 2.61 | |||
| K562 (myelogenous leukemia) | 1.90 | n/a | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis