rs4128572 chr5:153749155 A>G
- Sequence
caggagagagtggggcctaggagc[A/G]aagagaagtgttttcagaagaaat
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.11 | 0.67 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alcohol behavior (alcohol dependence factor score), bipolar disorder, cognitive response of healthy volunteers to topiramate treatment as measure by the delayed story recall cognitive test, cognitive response to topiramate treatment as measured by the controlled oral word association cognitive test, fasting insulin, homa-b, homa-ir