rs413092 chr1:16609286 G>T
- Sequence
cgttagttaatgcttattaaagta[G/T]ctttggaatctcatctactggtct
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells) HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- ELF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 1.21 | -0.83 | 1.79 | n/a | No Hit | |||
| IKZF2_HUMAN | 1.84 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2