rs4133395 chr8:107302743 T>G
- Sequence
ccgatcctccaacccactctttta[T/G]gtaaatatggaaagcaaattcttt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) CWR22 (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN GATA3_HUMAN ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.11 | 1.52 | 1.92 | -0.95 | Weak Discordant | |||
| GATA3_HUMAN | -0.83 | 1.54 | 1.75 | n/a | No Hit | |||
| ANDR_HUMAN | 0.24 | 1.16 | 1.60 | n/a | No Hit |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP amyotrophic lateral sclerosis (als) age of onset, body mass index (bmi), diastolic blood pressure (dbp), neuroticism, paternal transmission distortion, schizophrenia, transmission distortion