rs41385 chr5:58316011 T>A
- Sequence
tttgagaatattcttttatgataa[T/A]gactaaagctaaagtaaacatttc
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.08 | 0.12 | 1.44 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, diastolic blood pressure (dbp), hdl cholesterol, infant head circumference, total cholesterol, triglycerides, years of education