rs414174 chr21:45137346 C>G
- Sequence
cagccgcttgtgatcctgatatgt[C/G]gagagttctggaagactgatgact
- ASB in cell types
- K562 (myelogenous leukemia) tibial artery
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.49 | 0.32 | 1.33 | |||
| tibial artery | 1.23 | -1.52 | 1.33 |
Items per page:
1 – 2 of 2