rs41422846 chr15:78255736 T>C
- Sequence
gaatggtatcatgtattattgtct[T/C]aattggcatttcttggattagtag
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN426_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN426_HUMAN | 2.79 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP salmonella-induced pyroptosis, serum phytosterol, serum phytosterol (brassicasterol normalized to cholesterol), serum phytosterol (brassicasterol), serum phytosterol (campesterol normalized to cholesterol), serum phytosterol (campesterol), serum phytosterol (sitosterol normalized to cholesterol), serum phytosterol (sitosterol), serum phytosterol normalized to cholesterol
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Esophagus_Muscularis, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Thyroid