rs4143269 chr2:37832709 T>G
- Sequence
ctcaaatccctttttgtaaaggca[T/G]tgactgggccactgttttgcacag
- ASB in cell types
- A549 (lung carcinoma) GM12878 (female B-cells) foreskin keratinocyte HeLa Kyoto (cervical adenocarcinoma)
- ASB for transcription factors
- SMC3_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.75 | -0.14 | 1.32 | n/a | n/a | |||
| CTCF_HUMAN | 0.60 | 0.38 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2