rs4146186 chr5:136174183 C>A
- Sequence
taatctgctgcctatttgaggctt[C/A]tcttgtagatgcaggcagacatta
- ASB in cell types
- K562 (myelogenous leukemia) induced pluripotent stem cells CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- ARI1B_HUMAN MTG8R_HUMAN DUX4_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1B_HUMAN | n/a | 4.02 | 2.00 | n/a | n/a | |||
| MTG8R_HUMAN | n/a | 3.44 | 2.00 | n/a | n/a | |||
| DUX4_HUMAN | 2.74 | n/a | 1.00 | n/a | No Hit | |||
| NCOR1_HUMAN | n/a | 3.00 | 2.00 | n/a | n/a | |||
| GATA1_HUMAN | -2.04 | 2.25 | 1.78 | 5.00 | Concordant |
Items per page:
1 – 5 of 12
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, diabetic retinopathy in type 2 diabetes mellitus, ldl cholesterol, microalbuminuria, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood