rs4150989 chr19:40425735 A>G
- Sequence
attcacccggcccggccggggcag[A/G]cagcacgtagaggtccgtgcgtct
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.23 | 1.11 | 2.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.54 | 1.04 | 2.64 |
Items per page:
1 – 2 of 2