rs416281 chr10:117439597 A>G
- Sequence
agtttcactccatagagaactcca[A/G]gtctcctgggagagatggacagat
- ASB in cell types
- HepG2 (hepatoblastoma) A549 (lung carcinoma)
- ASB for transcription factors
- FOXA2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA2_HUMAN | -1.50 | 1.67 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1