rs417377 chr1:30519471 C>T
- Sequence
tgatgatgacagagaggatgatga[C/T]gatgatgatggaaaaaatgatgat
- ASB in cell types
- HEK293 (embryonic kidney) K562 (myelogenous leukemia) HEK293T (embryonic kidney)
- ASB for transcription factors
- KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| KDM1A_HUMAN | 1.25 | -1.04 | 1.33 | n/a | n/a |
Items per page:
1 – 1 of 1