rs41821 chr7:106611453 C>T
- Sequence
atcaattctctatctctgttgcca[C/T]gtcactgcagagtttcacatggtc
- ASB in cell types
- GM12878 (female B-cells)
- ASB for transcription factors
- ELF1_HUMAN TBX21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ELF1_HUMAN | 2.15 | n/a | 1.33 | n/a | No Hit | |||
| TBX21_HUMAN | 1.55 | -1.80 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, fasting insulin, homa-ir, partial epilepsy, refractive error, sporadic creutzfeldt-jakob disease, systolic blood pressure (sbp), total cholesterol, years of education