rs420217 chr22:22684964 T>C
- Sequence
cctgagacacttctgtagcaattg[T/C]tcctgccccacatccctgcactgc
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte pancreas
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.68 | -0.47 | 5.80 | |||
| foreskin keratinocyte | 1.69 | -0.34 | 2.00 | |||
| pancreas | -1.91 | 1.84 | 1.33 |
Items per page:
1 – 3 of 3