rs42200 chr7:108526395 T>C
- Sequence
cgtgatgcgcgaggcgtggcttgc[T/C]ggtggggcgtgctgtgccttggtt
- ASB in cell types
- K562 (myelogenous leukemia) upper lobe of left lung
- ASB for transcription factors
- ARNT_HUMAN SMCA4_HUMAN ATF4_HUMAN ZSC29_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | -0.36 | 1.20 | 1.37 | n/a | No Hit | |||
| SMCA4_HUMAN | -1.23 | 1.70 | 1.50 | n/a | n/a | |||
| ATF4_HUMAN | -1.85 | 1.67 | 1.33 | n/a | No Hit | |||
| ZSC29_HUMAN | -0.29 | 1.58 | 1.39 | n/a | n/a | |||
| IKZF1_HUMAN | -0.22 | 0.75 | 1.37 | n/a | No Hit |
Items per page:
1 – 5 of 7
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid