rs423639 chr6:33019997 C>T
- Sequence
tgagatgtcttcatgaggccaacc[C/T]ggagtgggactgccctcatttcca
- ASB in cell types
- GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | 0.73 | -0.09 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, bipolar disorder, chronic hepatitis b, chronic kidney disease, coronary artery disease (cad), hdl cholesterol change with statins, ldl cholesterol, mitral annular calcium, parkinsons disease, primary biliary cirrhosis, primary biliary cirrhosis (antimitochondrial-antibody positive only), rheumatoid arthritis, sporadic creutzfeldt-jakob disease, total cholesterol, type 1 diabetes