rs42646 chr7:90346606 T>A
- Sequence
tggggctggtggcgcccgagagca[T/A]cacacaacgcatgcgccagtccgc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD14+ monocytes monocyte-derived macrophages tibial nerve
- ASB for transcription factors
- CTCF_HUMAN GATA1_HUMAN STAT1_HUMAN ZEB2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.27 | 0.75 | 1.39 | n/a | No Hit | |||
| GATA1_HUMAN | 0.34 | 2.00 | 1.78 | n/a | No Hit | |||
| STAT1_HUMAN | 0.19 | 2.78 | 1.61 | n/a | No Hit | |||
| ZEB2_HUMAN | 1.62 | -1.44 | 1.00 | n/a | n/a | |||
| ESR1_HUMAN | -3.61 | 2.14 | 2.50 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Thyroid, Whole_Blood