rs427394 chr5:6745762 A>G
- Sequence
atgacctttacacagctaaaatca[A/G]tcctttcacttttccggttttatg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) foreskin keratinocyte HEK293 (embryonic kidney) PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.49 | 0.91 | 2.52 | |||
| foreskin keratinocyte | 0.61 | n/a | 2.33 | |||
| HEK293 (embryonic kidney) | 0.79 | -0.42 | 2.84 | |||
| PC9 (lung adenocarcinoma) | 2.25 | n/a | 3.67 |
Items per page:
1 – 4 of 4