rs4278886 chr2:237614101 C>T
- Sequence
ttgcctgcaaactccaaagcatga[C/T]gactgacctggtcatatactgttt
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.30 | 0.86 | 1.98 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, ldl cholesterol change with statins, schizophrenia, total cholesterol change with statins
GTEx eQTL Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Ovary, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid