rs4282339 chr5:168829235 G>A
- Sequence
tcactctgtgctttcctggctctg[G/A]ttgtaatctgcgtgttgtgtgtcc
- ASB in cell types
- SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SK-N-SH (neuroblastoma) | -0.18 | 1.02 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP height, hypertension (early onset hypertension), microalbuminuria, sporadic creutzfeldt-jakob disease
PheWAS alcoholic liver damage, alopecia areata, anaphylactic shock nos, av block, benign neoplasm of breast, bladder neck obstruction, cancer of kidney and renal pelvis, cancer of mouth, cardiac defibrillator in situ, central/nonobstroctive sleep apnea, chronic glomerulonephritis, delirium due to conditions classified elsewhere, dental caries, diseases of hard tissues of teeth, diseases of respiratory system, disorders of parathyroid gland, dysuria, epiphora, exophthalmos, generalized convulsive epilepsy, hypoparathyroidism, hypotension, hypotony of eye, impetigo, infections of kidney, infertility, female, lipoprotein disorders, myasthenia gravis, myoneural disorders, nodular lymphoma, osteitis deformans and osteopathies associated with other disorders, other disorders of gallbladder, other disorders of lipoid metabolism and hyperalimentation, other disorders of peritoneum, other local infections of skin and subcutaneous tissue, otosclerosis, pneumonia, polyarteritis nodosa and allied conditions, polycythemia vera, secondary, polyneuropathy in diabetes, renal cell carcinoma, respiratory insufficiency, secondary malignancy of lymph nodes, systemic lupus erythematosus, type 2 diabetic neuropathy, unspecified local infection of skin and subcutaneous tissue, urethritis and urethral syndrome, vascular dementia, vascular insufficiency of intestine