rs429560 chr22:22586995 T>C
- Sequence
gtcaagattagcatggatcgaggg[T/C]ctggtcctgagctgggaggagaaa
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) upper lobe of left lung neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 1.18 | -0.35 | 5.89 | |||
| HEK293 (embryonic kidney) | 0.66 | -0.21 | 2.05 | |||
| upper lobe of left lung | 0.99 | -0.52 | 1.22 | |||
| neural cell | 1.59 | n/a | 4.67 |
Items per page:
1 – 4 of 4