rs429738 chr22:21067136 A>C
- Sequence
tgtggacgttgtcctgcacaggag[A/C]ataggccttggatggtgaaaggaa
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -1.06 | 0.76 | 4.83 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, arthritis including non-rheumatoid, college completion, hdl cholesterol, longstanding arthritis, rheumatoid arthritis, sporadic creutzfeldt-jakob disease, years of education