rs4298432 chr7:129819738 A>G
- Sequence
gtgcatggatgagcttgtcaactg[A/G]tgaccttcaccaattgtaatctga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- Z518A_HUMAN ZN623_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| Z518A_HUMAN | n/a | 2.27 | 2.00 | n/a | n/a | |||
| ZN623_HUMAN | n/a | 2.33 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eye color, obesity with early age of onset (age >2), spine bone mineral density (bmd), tardive dyskinesia