rs4305 chr17:63480868 A>G
- Sequence
aggattgagtggctggggcctggc[A/G]cagccagaaatgacagtggcagca
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.57 | 0.58 | 1.70 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP arthritis including non-rheumatoid, body mass index (bmi), diastolic blood pressure (dbp), height, longstanding arthritis, microalbuminuria, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid