rs432114 chr21:14259866 C>G
- Sequence
acagtgagttggttgttatttaat[C/G]tgtccagtagatggtgccaaagta
- ASB in cell types
- gastroesophageal sphincter foreskin keratinocyte T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| gastroesophageal sphincter | -0.44 | 1.63 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.43 | 2.83 | |||
| T47D (invasive ductal carcinoma) | 1.22 | -0.17 | 2.00 |
Items per page:
1 – 3 of 3