rs4328857 chr3:178966681 G>A
- Sequence
gtggtttttcattttcattcgcaa[G/A]ccagtttcctgttcacgcttaaaa
- ASB in cell types
- foreskin keratinocyte GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 1.79 | 2.17 | |||
| GM12878 (female B-cells) | 0.18 | 0.59 | 1.29 |
Items per page:
1 – 2 of 2