rs433994 chr9:134025467 G>C
- Sequence
ccatggagacacggcccagcggcc[G/C]ccggccccgccctgggagccccgc
- ASB in cell types
- HepG2 (hepatoblastoma) T47D (invasive ductal carcinoma) NCI-H2171 (small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.30 | 0.77 | 1.27 | |||
| T47D (invasive ductal carcinoma) | 0.17 | 1.52 | 1.71 | |||
| NCI-H2171 (small cell lung carcinoma) | 1.65 | -0.93 | 1.50 |
Items per page:
1 – 3 of 3