rs4347484 chr13:24154212 C>A
- Sequence
taccactcctgggtaaatacccaa[C/A]aagagtgtgattttttttccacta
- ASB in cell types
- LNCaP (prostate carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.23 | 0.60 | 1.60 | n/a | No Hit | |||
| CTCF_HUMAN | 1.00 | n/a | 1.17 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, eye color, maternal transmission distortion, primary rhegmatogenous retinal detachment