rs434899 chr11:16857292 C>G
- Sequence
gcttcccaaagggctgggccctgt[C/G]ggatgcttggcagcaggagatgca
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells-derived proerythroblasts | 1.41 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP breast cancer, coronary artery disease (cad), diastolic blood pressure (dbp), hdl cholesterol, major depressive disorder (broad definition), major depressive disorder (broad definition) (males), major depressive disorder (narrow definition), major depressive disorder (narrow definition) (males), obesity with early age of onset (age >2), serum creatinine, systolic blood pressure (sbp)