rs435306 chr20:45909845 G>T
- Sequence
tttctgttacacagatgaagaaac[G/T]gaaactcaggaaggctaagggggc
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- NR2C1_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NR2C1_HUMAN | -0.33 | 1.81 | 2.00 | n/a | No Hit | |||
| LMBL2_HUMAN | -1.93 | 2.00 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood