rs436566 chr2:21228732 C>T
- Sequence
ctggttgacctgatagcagctgca[C/T]aggccctgctgagaggattgccat
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- TAL1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 2.07 | 0.50 | 1.75 | n/a | No Hit | |||
| GATA1_HUMAN | 1.63 | -1.95 | 1.50 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP autism with low iq, comorbid depressive syndrome and alcohol dependence, coronary artery disease (cad), diastolic blood pressure (dbp), hypertension (early onset hypertension), ldl cholesterol, parkinsons disease, prop taste detection threshold, refractive error, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Heart_Atrial_Appendage, Heart_Left_Ventricle, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg