rs4379922 chr12:124866570 T>C
- Sequence
accttgctttgtgtgaaatggtct[T/C]atctgtttccttgttcatctcctc
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.84 | -0.29 | 2.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, alzheimers disease, cystatin c in serum, diastolic blood pressure (dbp), hdl cholesterol, hdl cholesterol change with statins, renal cell carcinoma (renal cancer), triglycerides, triglycerides change with statins